Abstract
One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.