Abstract
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.