Background
Ovarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood.
Conclusions
Our study suggests that miR-448 has an inhibitory role in OC.
Methods
The miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays.
Results
In this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2. Conclusions: Our study suggests that miR-448 has an inhibitory role in OC.