Abstract
Bioinformatic analysis of Enterococcus faecalis temperate phage ϕEf11 identified prospective attP and attB core attachment (att) sites consisting of identical 27 nt sequences (ACTAAGCAAGTGCCGCCATGTGTCTGA). The presumptive attPcore site was located 74 nts from the terminus of the ϕEf11 integrase (ORF 31) while the presumptive attB site was located within ffs, encoding the 4.5S RNA component of the signal recognition particle (SRP). After examining 6,028 genomes of 61 Enterococcal species using updated Phage_Finder software, attL and attR sequences disrupting ffs could only be detected in lysogenic strains of E. faecalis. We have found no other example of a prophage inserted into ffs, therefore, the ffs locus for ϕEf11 integration represents a novel phage attachment site. SRP functions in the transport of proteins through the cellular membrane to the periplasmic space. Integration into ffs resulted in alteration of the 3' end of the 4.5 S RNA, where in E. coli, alterations in the same region cause defects in membrane protein insertion. Lysogens of ϕEf11 are resistant to the ϕEf11 endolysin. Since endolysin activity is dependent upon binding to cell surface receptors, it is conceivable that defective SRP function results in alteration of the endolysin receptor, preventing endolysin function.